ID: 1136730319

View in Genome Browser
Species Human (GRCh38)
Location 16:32405554-32405576
Sequence CGACATAAACATACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136730314_1136730319 22 Left 1136730314 16:32405509-32405531 CCTTTTTGGCCATCCTAATAAAC No data
Right 1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG No data
1136730317_1136730319 9 Left 1136730317 16:32405522-32405544 CCTAATAAACAAATGGTTGCTCT No data
Right 1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG No data
1136730316_1136730319 13 Left 1136730316 16:32405518-32405540 CCATCCTAATAAACAAATGGTTG No data
Right 1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136730319 Original CRISPR CGACATAAACATACAGAGCT GGG Intergenic
No off target data available for this crispr