ID: 1136735909

View in Genome Browser
Species Human (GRCh38)
Location 16:32467531-32467553
Sequence CTGGCTTTCGGCTGGTACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136735904_1136735909 -10 Left 1136735904 16:32467518-32467540 CCAGCAGGTCTACCTGGCTTTCG No data
Right 1136735909 16:32467531-32467553 CTGGCTTTCGGCTGGTACTAGGG No data
1136735903_1136735909 -9 Left 1136735903 16:32467517-32467539 CCCAGCAGGTCTACCTGGCTTTC No data
Right 1136735909 16:32467531-32467553 CTGGCTTTCGGCTGGTACTAGGG No data
1136735902_1136735909 -6 Left 1136735902 16:32467514-32467536 CCACCCAGCAGGTCTACCTGGCT No data
Right 1136735909 16:32467531-32467553 CTGGCTTTCGGCTGGTACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136735909 Original CRISPR CTGGCTTTCGGCTGGTACTA GGG Intergenic
No off target data available for this crispr