ID: 1136736778

View in Genome Browser
Species Human (GRCh38)
Location 16:32474011-32474033
Sequence CTGCGGGTCTTGGGGTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136736778_1136736786 4 Left 1136736778 16:32474011-32474033 CCATCTCACCCCAAGACCCGCAG No data
Right 1136736786 16:32474038-32474060 CACCACCAGACTCTGAGGCAGGG No data
1136736778_1136736790 11 Left 1136736778 16:32474011-32474033 CCATCTCACCCCAAGACCCGCAG No data
Right 1136736790 16:32474045-32474067 AGACTCTGAGGCAGGGAGGAAGG No data
1136736778_1136736788 7 Left 1136736778 16:32474011-32474033 CCATCTCACCCCAAGACCCGCAG No data
Right 1136736788 16:32474041-32474063 CACCAGACTCTGAGGCAGGGAGG No data
1136736778_1136736785 3 Left 1136736778 16:32474011-32474033 CCATCTCACCCCAAGACCCGCAG No data
Right 1136736785 16:32474037-32474059 ACACCACCAGACTCTGAGGCAGG No data
1136736778_1136736784 -1 Left 1136736778 16:32474011-32474033 CCATCTCACCCCAAGACCCGCAG No data
Right 1136736784 16:32474033-32474055 GCAGACACCACCAGACTCTGAGG No data
1136736778_1136736791 28 Left 1136736778 16:32474011-32474033 CCATCTCACCCCAAGACCCGCAG No data
Right 1136736791 16:32474062-32474084 GGAAGGACTGCATTTGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136736778 Original CRISPR CTGCGGGTCTTGGGGTGAGA TGG (reversed) Intergenic
No off target data available for this crispr