ID: 1136736833

View in Genome Browser
Species Human (GRCh38)
Location 16:32474213-32474235
Sequence TTCCCAGCTCAGTGCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136736833_1136736840 20 Left 1136736833 16:32474213-32474235 CCTCTTTGGCACTGAGCTGGGAA No data
Right 1136736840 16:32474256-32474278 CTAGCAAGCAGAGGCCCGTGTGG No data
1136736833_1136736841 25 Left 1136736833 16:32474213-32474235 CCTCTTTGGCACTGAGCTGGGAA No data
Right 1136736841 16:32474261-32474283 AAGCAGAGGCCCGTGTGGTCAGG No data
1136736833_1136736835 -3 Left 1136736833 16:32474213-32474235 CCTCTTTGGCACTGAGCTGGGAA No data
Right 1136736835 16:32474233-32474255 GAACATGGTGTCCGCACTCCCGG No data
1136736833_1136736842 28 Left 1136736833 16:32474213-32474235 CCTCTTTGGCACTGAGCTGGGAA No data
Right 1136736842 16:32474264-32474286 CAGAGGCCCGTGTGGTCAGGTGG No data
1136736833_1136736837 11 Left 1136736833 16:32474213-32474235 CCTCTTTGGCACTGAGCTGGGAA No data
Right 1136736837 16:32474247-32474269 CACTCCCGGCTAGCAAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136736833 Original CRISPR TTCCCAGCTCAGTGCCAAAG AGG (reversed) Intergenic
No off target data available for this crispr