ID: 1136744063

View in Genome Browser
Species Human (GRCh38)
Location 16:32567785-32567807
Sequence CTTCTATCCAGTTTTTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136744063_1136744064 7 Left 1136744063 16:32567785-32567807 CCTACATAAAAACTGGATAGAAG No data
Right 1136744064 16:32567815-32567837 TCAAAATACTTTGTGATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136744063 Original CRISPR CTTCTATCCAGTTTTTATGT AGG (reversed) Intergenic
No off target data available for this crispr