ID: 1136747314

View in Genome Browser
Species Human (GRCh38)
Location 16:32602238-32602260
Sequence GGAGTCTGTAGAACTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136747308_1136747314 23 Left 1136747308 16:32602192-32602214 CCATTATCAACATTTCCACATTC No data
Right 1136747314 16:32602238-32602260 GGAGTCTGTAGAACTTCCTCAGG No data
1136747311_1136747314 8 Left 1136747311 16:32602207-32602229 CCACATTCAGACTAGGGATTAGA No data
Right 1136747314 16:32602238-32602260 GGAGTCTGTAGAACTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136747314 Original CRISPR GGAGTCTGTAGAACTTCCTC AGG Intergenic
No off target data available for this crispr