ID: 1136748337

View in Genome Browser
Species Human (GRCh38)
Location 16:32612010-32612032
Sequence GGTGAACTCAGCCAAGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136748332_1136748337 24 Left 1136748332 16:32611963-32611985 CCACACTAGATGCAAGAGAGGTG No data
Right 1136748337 16:32612010-32612032 GGTGAACTCAGCCAAGGGAGAGG No data
1136748334_1136748337 -8 Left 1136748334 16:32611995-32612017 CCTGCTTCAGTGCAAGGTGAACT 0: 4
1: 0
2: 1
3: 8
4: 101
Right 1136748337 16:32612010-32612032 GGTGAACTCAGCCAAGGGAGAGG No data
1136748331_1136748337 25 Left 1136748331 16:32611962-32611984 CCCACACTAGATGCAAGAGAGGT No data
Right 1136748337 16:32612010-32612032 GGTGAACTCAGCCAAGGGAGAGG No data
1136748329_1136748337 26 Left 1136748329 16:32611961-32611983 CCCCACACTAGATGCAAGAGAGG No data
Right 1136748337 16:32612010-32612032 GGTGAACTCAGCCAAGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136748337 Original CRISPR GGTGAACTCAGCCAAGGGAG AGG Intergenic
No off target data available for this crispr