ID: 1136750226

View in Genome Browser
Species Human (GRCh38)
Location 16:32628888-32628910
Sequence TGCCCACAGCTCCCCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136750222_1136750226 11 Left 1136750222 16:32628854-32628876 CCACATCAGTGTGAATGCTTTTG No data
Right 1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG No data
1136750221_1136750226 12 Left 1136750221 16:32628853-32628875 CCCACATCAGTGTGAATGCTTTT No data
Right 1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136750226 Original CRISPR TGCCCACAGCTCCCCCGGGC TGG Intergenic
No off target data available for this crispr