ID: 1136763260

View in Genome Browser
Species Human (GRCh38)
Location 16:32752462-32752484
Sequence CCTGCTAACCAGACAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136763260_1136763264 -5 Left 1136763260 16:32752462-32752484 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1136763264 16:32752480-32752502 GCAGGAGGTACAATTTGTACAGG No data
1136763260_1136763265 -1 Left 1136763260 16:32752462-32752484 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1136763265 16:32752484-32752506 GAGGTACAATTTGTACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136763260 Original CRISPR CCTGCTAACCAGACAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr