ID: 1136764881

View in Genome Browser
Species Human (GRCh38)
Location 16:32768814-32768836
Sequence GCACGTGGCCATCAGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136764881_1136764890 21 Left 1136764881 16:32768814-32768836 CCTGTGAGCTGATGGCCACGTGC No data
Right 1136764890 16:32768858-32768880 TAGTTAGGGATATACTTCATGGG No data
1136764881_1136764891 28 Left 1136764881 16:32768814-32768836 CCTGTGAGCTGATGGCCACGTGC No data
Right 1136764891 16:32768865-32768887 GGATATACTTCATGGGCCTGTGG No data
1136764881_1136764889 20 Left 1136764881 16:32768814-32768836 CCTGTGAGCTGATGGCCACGTGC No data
Right 1136764889 16:32768857-32768879 GTAGTTAGGGATATACTTCATGG No data
1136764881_1136764884 7 Left 1136764881 16:32768814-32768836 CCTGTGAGCTGATGGCCACGTGC No data
Right 1136764884 16:32768844-32768866 TGCCCTGAACCCAGTAGTTAGGG No data
1136764881_1136764883 6 Left 1136764881 16:32768814-32768836 CCTGTGAGCTGATGGCCACGTGC No data
Right 1136764883 16:32768843-32768865 GTGCCCTGAACCCAGTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136764881 Original CRISPR GCACGTGGCCATCAGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr