ID: 1136769131

View in Genome Browser
Species Human (GRCh38)
Location 16:32818999-32819021
Sequence GCCTTGTAATACGCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136769128_1136769131 -1 Left 1136769128 16:32818977-32818999 CCAGGATGGTCTCGATCTCCTGG 0: 389
1: 53730
2: 75466
3: 152867
4: 231362
Right 1136769131 16:32818999-32819021 GCCTTGTAATACGCCCGCCTTGG No data
1136769127_1136769131 8 Left 1136769127 16:32818968-32818990 CCATCTTAGCCAGGATGGTCTCG 0: 183
1: 38526
2: 55305
3: 96523
4: 180696
Right 1136769131 16:32818999-32819021 GCCTTGTAATACGCCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136769131 Original CRISPR GCCTTGTAATACGCCCGCCT TGG Intergenic
No off target data available for this crispr