ID: 1136772008

View in Genome Browser
Species Human (GRCh38)
Location 16:32848222-32848244
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136772008_1136772011 6 Left 1136772008 16:32848222-32848244 CCCTACCTCTGCAGAACAGGAAA No data
Right 1136772011 16:32848251-32848273 CTGAGATGCCATTTCCTGCCAGG No data
1136772008_1136772012 7 Left 1136772008 16:32848222-32848244 CCCTACCTCTGCAGAACAGGAAA No data
Right 1136772012 16:32848252-32848274 TGAGATGCCATTTCCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136772008 Original CRISPR TTTCCTGTTCTGCAGAGGTA GGG (reversed) Intergenic
No off target data available for this crispr