ID: 1136772012

View in Genome Browser
Species Human (GRCh38)
Location 16:32848252-32848274
Sequence TGAGATGCCATTTCCTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136772005_1136772012 11 Left 1136772005 16:32848218-32848240 CCCTCCCTACCTCTGCAGAACAG No data
Right 1136772012 16:32848252-32848274 TGAGATGCCATTTCCTGCCAGGG No data
1136772010_1136772012 2 Left 1136772010 16:32848227-32848249 CCTCTGCAGAACAGGAAAGTGTG No data
Right 1136772012 16:32848252-32848274 TGAGATGCCATTTCCTGCCAGGG No data
1136772009_1136772012 6 Left 1136772009 16:32848223-32848245 CCTACCTCTGCAGAACAGGAAAG No data
Right 1136772012 16:32848252-32848274 TGAGATGCCATTTCCTGCCAGGG No data
1136772008_1136772012 7 Left 1136772008 16:32848222-32848244 CCCTACCTCTGCAGAACAGGAAA No data
Right 1136772012 16:32848252-32848274 TGAGATGCCATTTCCTGCCAGGG No data
1136772006_1136772012 10 Left 1136772006 16:32848219-32848241 CCTCCCTACCTCTGCAGAACAGG No data
Right 1136772012 16:32848252-32848274 TGAGATGCCATTTCCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136772012 Original CRISPR TGAGATGCCATTTCCTGCCA GGG Intergenic
No off target data available for this crispr