ID: 1136774634

View in Genome Browser
Species Human (GRCh38)
Location 16:32865247-32865269
Sequence TGGACTTGGGGCAGCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136774625_1136774634 30 Left 1136774625 16:32865194-32865216 CCAGTGTCTGTGTGCTGGGAGGC No data
Right 1136774634 16:32865247-32865269 TGGACTTGGGGCAGCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136774634 Original CRISPR TGGACTTGGGGCAGCCCTTT GGG Intergenic