ID: 1136776200

View in Genome Browser
Species Human (GRCh38)
Location 16:32873108-32873130
Sequence ATGGACAAGAAGAAAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136776193_1136776200 5 Left 1136776193 16:32873080-32873102 CCCTTTCCAGGCTACAGTAGTTG No data
Right 1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG No data
1136776194_1136776200 4 Left 1136776194 16:32873081-32873103 CCTTTCCAGGCTACAGTAGTTGG No data
Right 1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG No data
1136776196_1136776200 -1 Left 1136776196 16:32873086-32873108 CCAGGCTACAGTAGTTGGTCCCA No data
Right 1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG No data
1136776191_1136776200 27 Left 1136776191 16:32873058-32873080 CCTACTGCTGTGGGATTTCTGTC No data
Right 1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136776200 Original CRISPR ATGGACAAGAAGAAAGAGTA AGG Intergenic
No off target data available for this crispr