ID: 1136777230

View in Genome Browser
Species Human (GRCh38)
Location 16:32878522-32878544
Sequence CAGAACCTGGAGAGGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136777218_1136777230 25 Left 1136777218 16:32878474-32878496 CCACTGCTGCTTCTGGGGTGAGG No data
Right 1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG No data
1136777225_1136777230 -4 Left 1136777225 16:32878503-32878525 CCAAGGGTGTGCTACAGAGCAGA No data
Right 1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG No data
1136777224_1136777230 -3 Left 1136777224 16:32878502-32878524 CCCAAGGGTGTGCTACAGAGCAG No data
Right 1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136777230 Original CRISPR CAGAACCTGGAGAGGTGGGC AGG Intergenic
No off target data available for this crispr