ID: 1136778665

View in Genome Browser
Species Human (GRCh38)
Location 16:32884485-32884507
Sequence CAAAGTTAGGAGAAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136778665_1136778675 23 Left 1136778665 16:32884485-32884507 CCAGCATCCTTCTCCTAACTTTG No data
Right 1136778675 16:32884531-32884553 TCTGTTTCCCACCCATCACTGGG No data
1136778665_1136778674 22 Left 1136778665 16:32884485-32884507 CCAGCATCCTTCTCCTAACTTTG No data
Right 1136778674 16:32884530-32884552 CTCTGTTTCCCACCCATCACTGG 0: 4
1: 0
2: 1
3: 24
4: 240
1136778665_1136778671 -3 Left 1136778665 16:32884485-32884507 CCAGCATCCTTCTCCTAACTTTG No data
Right 1136778671 16:32884505-32884527 TTGGGCAAAGGCCTTTGCTCTGG 0: 4
1: 0
2: 2
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136778665 Original CRISPR CAAAGTTAGGAGAAGGATGC TGG (reversed) Intergenic
No off target data available for this crispr