ID: 1136778902

View in Genome Browser
Species Human (GRCh38)
Location 16:32885333-32885355
Sequence GCCGCCGCGCGCGATAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136778902_1136778906 -3 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778906 16:32885353-32885375 GGCACGGCCAGGCCGCCGCCGGG No data
1136778902_1136778913 15 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778913 16:32885371-32885393 CCGGGTGTCCCCAGGCCCGCGGG No data
1136778902_1136778914 16 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778914 16:32885372-32885394 CGGGTGTCCCCAGGCCCGCGGGG No data
1136778902_1136778918 29 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG No data
1136778902_1136778911 14 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778911 16:32885370-32885392 GCCGGGTGTCCCCAGGCCCGCGG No data
1136778902_1136778908 7 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778908 16:32885363-32885385 GGCCGCCGCCGGGTGTCCCCAGG No data
1136778902_1136778905 -4 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778905 16:32885352-32885374 CGGCACGGCCAGGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136778902 Original CRISPR GCCGCCGCGCGCGATAGACC TGG (reversed) Intergenic
No off target data available for this crispr