ID: 1136778909

View in Genome Browser
Species Human (GRCh38)
Location 16:32885365-32885387
Sequence GGCCTGGGGACACCCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136778909_1136778918 -3 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG No data
1136778909_1136778921 2 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778921 16:32885390-32885412 CGGGGCCGTCGCCCTTGGCCCGG No data
1136778909_1136778922 3 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778922 16:32885391-32885413 GGGGCCGTCGCCCTTGGCCCGGG No data
1136778909_1136778936 30 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778936 16:32885418-32885440 GTCGGGCCCGGGCGCGATGAGGG No data
1136778909_1136778924 12 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778924 16:32885400-32885422 GCCCTTGGCCCGGGCCCCGTCGG No data
1136778909_1136778935 29 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778935 16:32885417-32885439 CGTCGGGCCCGGGCGCGATGAGG No data
1136778909_1136778926 13 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778926 16:32885401-32885423 CCCTTGGCCCGGGCCCCGTCGGG No data
1136778909_1136778928 18 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778928 16:32885406-32885428 GGCCCGGGCCCCGTCGGGCCCGG No data
1136778909_1136778929 19 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778929 16:32885407-32885429 GCCCGGGCCCCGTCGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136778909 Original CRISPR GGCCTGGGGACACCCGGCGG CGG (reversed) Intergenic
No off target data available for this crispr