ID: 1136778918

View in Genome Browser
Species Human (GRCh38)
Location 16:32885385-32885407
Sequence GCCCGCGGGGCCGTCGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136778907_1136778918 2 Left 1136778907 16:32885360-32885382 CCAGGCCGCCGCCGGGTGTCCCC No data
Right 1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG No data
1136778902_1136778918 29 Left 1136778902 16:32885333-32885355 CCAGGTCTATCGCGCGCGGCGGC No data
Right 1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG No data
1136778910_1136778918 -6 Left 1136778910 16:32885368-32885390 CCGCCGGGTGTCCCCAGGCCCGC No data
Right 1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG No data
1136778909_1136778918 -3 Left 1136778909 16:32885365-32885387 CCGCCGCCGGGTGTCCCCAGGCC No data
Right 1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG No data
1136778912_1136778918 -9 Left 1136778912 16:32885371-32885393 CCGGGTGTCCCCAGGCCCGCGGG No data
Right 1136778918 16:32885385-32885407 GCCCGCGGGGCCGTCGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136778918 Original CRISPR GCCCGCGGGGCCGTCGCCCT TGG Intergenic
No off target data available for this crispr