ID: 1136779105

View in Genome Browser
Species Human (GRCh38)
Location 16:32885961-32885983
Sequence GTGAGCCGGGCAGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136779105_1136779110 -8 Left 1136779105 16:32885961-32885983 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1136779110 16:32885976-32885998 CGGCTCACCCGAGACTCCGGTGG No data
1136779105_1136779116 4 Left 1136779105 16:32885961-32885983 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1136779116 16:32885988-32886010 GACTCCGGTGGCGGCGGCGGCGG No data
1136779105_1136779112 -2 Left 1136779105 16:32885961-32885983 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1136779112 16:32885982-32886004 ACCCGAGACTCCGGTGGCGGCGG No data
1136779105_1136779115 1 Left 1136779105 16:32885961-32885983 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1136779115 16:32885985-32886007 CGAGACTCCGGTGGCGGCGGCGG No data
1136779105_1136779118 10 Left 1136779105 16:32885961-32885983 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1136779118 16:32885994-32886016 GGTGGCGGCGGCGGCGGCTCAGG No data
1136779105_1136779111 -5 Left 1136779105 16:32885961-32885983 CCCGCGGCGGCTGCCCGGCTCAC No data
Right 1136779111 16:32885979-32886001 CTCACCCGAGACTCCGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136779105 Original CRISPR GTGAGCCGGGCAGCCGCCGC GGG (reversed) Intergenic
No off target data available for this crispr