ID: 1136779114

View in Genome Browser
Species Human (GRCh38)
Location 16:32885984-32886006
Sequence CGCCGCCGCCACCGGAGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136779114_1136779122 14 Left 1136779114 16:32885984-32886006 CCGAGACTCCGGTGGCGGCGGCG No data
Right 1136779122 16:32886021-32886043 CCTCGCCCTCTCCTTCTGGGCGG No data
1136779114_1136779120 11 Left 1136779114 16:32885984-32886006 CCGAGACTCCGGTGGCGGCGGCG No data
Right 1136779120 16:32886018-32886040 GCGCCTCGCCCTCTCCTTCTGGG No data
1136779114_1136779123 17 Left 1136779114 16:32885984-32886006 CCGAGACTCCGGTGGCGGCGGCG No data
Right 1136779123 16:32886024-32886046 CGCCCTCTCCTTCTGGGCGGCGG No data
1136779114_1136779119 10 Left 1136779114 16:32885984-32886006 CCGAGACTCCGGTGGCGGCGGCG No data
Right 1136779119 16:32886017-32886039 CGCGCCTCGCCCTCTCCTTCTGG No data
1136779114_1136779126 20 Left 1136779114 16:32885984-32886006 CCGAGACTCCGGTGGCGGCGGCG No data
Right 1136779126 16:32886027-32886049 CCTCTCCTTCTGGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136779114 Original CRISPR CGCCGCCGCCACCGGAGTCT CGG (reversed) Intergenic
No off target data available for this crispr