ID: 1136784391

View in Genome Browser
Species Human (GRCh38)
Location 16:32925973-32925995
Sequence TCCCTGTCATCATTAGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136784391_1136784395 11 Left 1136784391 16:32925973-32925995 CCTGACCCTAATGATGACAGGGA No data
Right 1136784395 16:32926007-32926029 GTGTTAGGATCGCCATGAGCAGG No data
1136784391_1136784396 22 Left 1136784391 16:32925973-32925995 CCTGACCCTAATGATGACAGGGA No data
Right 1136784396 16:32926018-32926040 GCCATGAGCAGGCTCTGATGTGG No data
1136784391_1136784398 27 Left 1136784391 16:32925973-32925995 CCTGACCCTAATGATGACAGGGA No data
Right 1136784398 16:32926023-32926045 GAGCAGGCTCTGATGTGGAGTGG No data
1136784391_1136784394 -4 Left 1136784391 16:32925973-32925995 CCTGACCCTAATGATGACAGGGA No data
Right 1136784394 16:32925992-32926014 GGGATTATTGTGACTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136784391 Original CRISPR TCCCTGTCATCATTAGGGTC AGG (reversed) Intergenic
No off target data available for this crispr