ID: 1136784392

View in Genome Browser
Species Human (GRCh38)
Location 16:32925978-32926000
Sequence AATAATCCCTGTCATCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136784392_1136784398 22 Left 1136784392 16:32925978-32926000 CCCTAATGATGACAGGGATTATT No data
Right 1136784398 16:32926023-32926045 GAGCAGGCTCTGATGTGGAGTGG No data
1136784392_1136784395 6 Left 1136784392 16:32925978-32926000 CCCTAATGATGACAGGGATTATT No data
Right 1136784395 16:32926007-32926029 GTGTTAGGATCGCCATGAGCAGG No data
1136784392_1136784396 17 Left 1136784392 16:32925978-32926000 CCCTAATGATGACAGGGATTATT No data
Right 1136784396 16:32926018-32926040 GCCATGAGCAGGCTCTGATGTGG No data
1136784392_1136784394 -9 Left 1136784392 16:32925978-32926000 CCCTAATGATGACAGGGATTATT No data
Right 1136784394 16:32925992-32926014 GGGATTATTGTGACTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136784392 Original CRISPR AATAATCCCTGTCATCATTA GGG (reversed) Intergenic
No off target data available for this crispr