ID: 1136784398

View in Genome Browser
Species Human (GRCh38)
Location 16:32926023-32926045
Sequence GAGCAGGCTCTGATGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136784391_1136784398 27 Left 1136784391 16:32925973-32925995 CCTGACCCTAATGATGACAGGGA No data
Right 1136784398 16:32926023-32926045 GAGCAGGCTCTGATGTGGAGTGG No data
1136784393_1136784398 21 Left 1136784393 16:32925979-32926001 CCTAATGATGACAGGGATTATTG No data
Right 1136784398 16:32926023-32926045 GAGCAGGCTCTGATGTGGAGTGG No data
1136784392_1136784398 22 Left 1136784392 16:32925978-32926000 CCCTAATGATGACAGGGATTATT No data
Right 1136784398 16:32926023-32926045 GAGCAGGCTCTGATGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136784398 Original CRISPR GAGCAGGCTCTGATGTGGAG TGG Intergenic
No off target data available for this crispr