ID: 1136784582

View in Genome Browser
Species Human (GRCh38)
Location 16:32926960-32926982
Sequence CATGGAGGAGGTGCCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136784582_1136784587 -3 Left 1136784582 16:32926960-32926982 CCTCCTGGGGCACCTCCTCCATG No data
Right 1136784587 16:32926980-32927002 ATGCCTGCTCAGCATCTGCCAGG No data
1136784582_1136784589 4 Left 1136784582 16:32926960-32926982 CCTCCTGGGGCACCTCCTCCATG No data
Right 1136784589 16:32926987-32927009 CTCAGCATCTGCCAGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136784582 Original CRISPR CATGGAGGAGGTGCCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr