ID: 1136786826

View in Genome Browser
Species Human (GRCh38)
Location 16:32939825-32939847
Sequence CTGGCCCCACTGAGGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136786816_1136786826 16 Left 1136786816 16:32939786-32939808 CCTGACATCAGGAGGCCCCGGCT No data
Right 1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG No data
1136786819_1136786826 -1 Left 1136786819 16:32939803-32939825 CCGGCTCTAGTGACTTTCCCTGC No data
Right 1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG No data
1136786812_1136786826 27 Left 1136786812 16:32939775-32939797 CCAAGGTCTGGCCTGACATCAGG No data
Right 1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG No data
1136786818_1136786826 0 Left 1136786818 16:32939802-32939824 CCCGGCTCTAGTGACTTTCCCTG No data
Right 1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG No data
1136786817_1136786826 1 Left 1136786817 16:32939801-32939823 CCCCGGCTCTAGTGACTTTCCCT No data
Right 1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136786826 Original CRISPR CTGGCCCCACTGAGGTTTTG GGG Intergenic
No off target data available for this crispr