ID: 1136787837

View in Genome Browser
Species Human (GRCh38)
Location 16:32946224-32946246
Sequence GGCACCCCCCTCTGGGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136787826_1136787837 14 Left 1136787826 16:32946187-32946209 CCCGGTCTGATGGAGGAGACACC No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data
1136787819_1136787837 29 Left 1136787819 16:32946172-32946194 CCCTGCCCCAGTGAGCCCGGTCT No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data
1136787824_1136787837 22 Left 1136787824 16:32946179-32946201 CCAGTGAGCCCGGTCTGATGGAG No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data
1136787821_1136787837 24 Left 1136787821 16:32946177-32946199 CCCCAGTGAGCCCGGTCTGATGG No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data
1136787827_1136787837 13 Left 1136787827 16:32946188-32946210 CCGGTCTGATGGAGGAGACACCG No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data
1136787820_1136787837 28 Left 1136787820 16:32946173-32946195 CCTGCCCCAGTGAGCCCGGTCTG No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data
1136787831_1136787837 -7 Left 1136787831 16:32946208-32946230 CCGGCTCTGTCATCAGGGCACCC No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data
1136787823_1136787837 23 Left 1136787823 16:32946178-32946200 CCCAGTGAGCCCGGTCTGATGGA No data
Right 1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136787837 Original CRISPR GGCACCCCCCTCTGGGGGGT CGG Intergenic
No off target data available for this crispr