ID: 1136791034

View in Genome Browser
Species Human (GRCh38)
Location 16:32968384-32968406
Sequence TGGGCTGGGAGGCATCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791034_1136791041 -2 Left 1136791034 16:32968384-32968406 CCACACGGATGCCTCCCAGCCCA No data
Right 1136791041 16:32968405-32968427 CATAAATGTGCAGGAACCAAAGG No data
1136791034_1136791042 -1 Left 1136791034 16:32968384-32968406 CCACACGGATGCCTCCCAGCCCA No data
Right 1136791042 16:32968406-32968428 ATAAATGTGCAGGAACCAAAGGG No data
1136791034_1136791045 24 Left 1136791034 16:32968384-32968406 CCACACGGATGCCTCCCAGCCCA No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791034_1136791044 23 Left 1136791034 16:32968384-32968406 CCACACGGATGCCTCCCAGCCCA No data
Right 1136791044 16:32968430-32968452 AAGAAAGATGCAAATCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791034 Original CRISPR TGGGCTGGGAGGCATCCGTG TGG (reversed) Intergenic
No off target data available for this crispr