ID: 1136791035

View in Genome Browser
Species Human (GRCh38)
Location 16:32968395-32968417
Sequence CTGCACATTTATGGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791035_1136791044 12 Left 1136791035 16:32968395-32968417 CCTCCCAGCCCATAAATGTGCAG No data
Right 1136791044 16:32968430-32968452 AAGAAAGATGCAAATCCCACTGG No data
1136791035_1136791047 27 Left 1136791035 16:32968395-32968417 CCTCCCAGCCCATAAATGTGCAG No data
Right 1136791047 16:32968445-32968467 CCCACTGGGCTTCCCCCGAGCGG No data
1136791035_1136791045 13 Left 1136791035 16:32968395-32968417 CCTCCCAGCCCATAAATGTGCAG No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791035 Original CRISPR CTGCACATTTATGGGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr