ID: 1136791037

View in Genome Browser
Species Human (GRCh38)
Location 16:32968398-32968420
Sequence TTCCTGCACATTTATGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791037_1136791044 9 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791044 16:32968430-32968452 AAGAAAGATGCAAATCCCACTGG No data
1136791037_1136791045 10 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791037_1136791049 28 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791049 16:32968449-32968471 CTGGGCTTCCCCCGAGCGGTTGG No data
1136791037_1136791047 24 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791047 16:32968445-32968467 CCCACTGGGCTTCCCCCGAGCGG No data
1136791037_1136791051 30 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791037_1136791050 29 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791037 Original CRISPR TTCCTGCACATTTATGGGCT GGG (reversed) Intergenic
No off target data available for this crispr