ID: 1136791039

View in Genome Browser
Species Human (GRCh38)
Location 16:32968403-32968425
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791039_1136791044 4 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791044 16:32968430-32968452 AAGAAAGATGCAAATCCCACTGG No data
1136791039_1136791050 24 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG No data
1136791039_1136791053 30 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791053 16:32968456-32968478 TCCCCCGAGCGGTTGGGGCAGGG No data
1136791039_1136791051 25 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791039_1136791045 5 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791039_1136791047 19 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791047 16:32968445-32968467 CCCACTGGGCTTCCCCCGAGCGG No data
1136791039_1136791052 29 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791052 16:32968455-32968477 TTCCCCCGAGCGGTTGGGGCAGG No data
1136791039_1136791049 23 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791049 16:32968449-32968471 CTGGGCTTCCCCCGAGCGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791039 Original CRISPR TTTGGTTCCTGCACATTTAT GGG (reversed) Intergenic
No off target data available for this crispr