ID: 1136791040

View in Genome Browser
Species Human (GRCh38)
Location 16:32968404-32968426
Sequence CTTTGGTTCCTGCACATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791040_1136791053 29 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791053 16:32968456-32968478 TCCCCCGAGCGGTTGGGGCAGGG No data
1136791040_1136791052 28 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791052 16:32968455-32968477 TTCCCCCGAGCGGTTGGGGCAGG No data
1136791040_1136791050 23 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG No data
1136791040_1136791047 18 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791047 16:32968445-32968467 CCCACTGGGCTTCCCCCGAGCGG No data
1136791040_1136791051 24 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791040_1136791045 4 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791040_1136791049 22 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791049 16:32968449-32968471 CTGGGCTTCCCCCGAGCGGTTGG No data
1136791040_1136791044 3 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791044 16:32968430-32968452 AAGAAAGATGCAAATCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791040 Original CRISPR CTTTGGTTCCTGCACATTTA TGG (reversed) Intergenic