ID: 1136791042

View in Genome Browser
Species Human (GRCh38)
Location 16:32968406-32968428
Sequence ATAAATGTGCAGGAACCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791032_1136791042 27 Left 1136791032 16:32968356-32968378 CCAGCACACACACAGGCTGCACG No data
Right 1136791042 16:32968406-32968428 ATAAATGTGCAGGAACCAAAGGG No data
1136791034_1136791042 -1 Left 1136791034 16:32968384-32968406 CCACACGGATGCCTCCCAGCCCA No data
Right 1136791042 16:32968406-32968428 ATAAATGTGCAGGAACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791042 Original CRISPR ATAAATGTGCAGGAACCAAA GGG Intergenic