ID: 1136791043

View in Genome Browser
Species Human (GRCh38)
Location 16:32968421-32968443
Sequence TTTGCATCTTTCTTTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791043_1136791047 1 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791047 16:32968445-32968467 CCCACTGGGCTTCCCCCGAGCGG No data
1136791043_1136791049 5 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791049 16:32968449-32968471 CTGGGCTTCCCCCGAGCGGTTGG No data
1136791043_1136791053 12 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791053 16:32968456-32968478 TCCCCCGAGCGGTTGGGGCAGGG No data
1136791043_1136791050 6 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG No data
1136791043_1136791052 11 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791052 16:32968455-32968477 TTCCCCCGAGCGGTTGGGGCAGG No data
1136791043_1136791051 7 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791043_1136791058 19 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791058 16:32968463-32968485 AGCGGTTGGGGCAGGGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791043 Original CRISPR TTTGCATCTTTCTTTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr