ID: 1136791045

View in Genome Browser
Species Human (GRCh38)
Location 16:32968431-32968453
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791035_1136791045 13 Left 1136791035 16:32968395-32968417 CCTCCCAGCCCATAAATGTGCAG No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791040_1136791045 4 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791038_1136791045 9 Left 1136791038 16:32968399-32968421 CCAGCCCATAAATGTGCAGGAAC No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791039_1136791045 5 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791034_1136791045 24 Left 1136791034 16:32968384-32968406 CCACACGGATGCCTCCCAGCCCA No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data
1136791037_1136791045 10 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791045 16:32968431-32968453 AGAAAGATGCAAATCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791045 Original CRISPR AGAAAGATGCAAATCCCACT GGG Intergenic