ID: 1136791051

View in Genome Browser
Species Human (GRCh38)
Location 16:32968451-32968473
Sequence GGGCTTCCCCCGAGCGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791037_1136791051 30 Left 1136791037 16:32968398-32968420 CCCAGCCCATAAATGTGCAGGAA No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791043_1136791051 7 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791040_1136791051 24 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791038_1136791051 29 Left 1136791038 16:32968399-32968421 CCAGCCCATAAATGTGCAGGAAC No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data
1136791039_1136791051 25 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791051 16:32968451-32968473 GGGCTTCCCCCGAGCGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791051 Original CRISPR GGGCTTCCCCCGAGCGGTTG GGG Intergenic
No off target data available for this crispr