ID: 1136791052

View in Genome Browser
Species Human (GRCh38)
Location 16:32968455-32968477
Sequence TTCCCCCGAGCGGTTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791043_1136791052 11 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791052 16:32968455-32968477 TTCCCCCGAGCGGTTGGGGCAGG No data
1136791040_1136791052 28 Left 1136791040 16:32968404-32968426 CCATAAATGTGCAGGAACCAAAG No data
Right 1136791052 16:32968455-32968477 TTCCCCCGAGCGGTTGGGGCAGG No data
1136791039_1136791052 29 Left 1136791039 16:32968403-32968425 CCCATAAATGTGCAGGAACCAAA No data
Right 1136791052 16:32968455-32968477 TTCCCCCGAGCGGTTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791052 Original CRISPR TTCCCCCGAGCGGTTGGGGC AGG Intergenic
No off target data available for this crispr