ID: 1136791058

View in Genome Browser
Species Human (GRCh38)
Location 16:32968463-32968485
Sequence AGCGGTTGGGGCAGGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136791048_1136791058 -6 Left 1136791048 16:32968446-32968468 CCACTGGGCTTCCCCCGAGCGGT No data
Right 1136791058 16:32968463-32968485 AGCGGTTGGGGCAGGGCCCGTGG No data
1136791043_1136791058 19 Left 1136791043 16:32968421-32968443 CCAAAGGGAAAGAAAGATGCAAA No data
Right 1136791058 16:32968463-32968485 AGCGGTTGGGGCAGGGCCCGTGG No data
1136791046_1136791058 -5 Left 1136791046 16:32968445-32968467 CCCACTGGGCTTCCCCCGAGCGG No data
Right 1136791058 16:32968463-32968485 AGCGGTTGGGGCAGGGCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136791058 Original CRISPR AGCGGTTGGGGCAGGGCCCG TGG Intergenic
No off target data available for this crispr