ID: 1136800090

View in Genome Browser
Species Human (GRCh38)
Location 16:33062025-33062047
Sequence TTTTTAAAAATTTTAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136800090_1136800098 25 Left 1136800090 16:33062025-33062047 CCTGTGTTTAAAATTTTTAAAAA No data
Right 1136800098 16:33062073-33062095 TGGACTATGCCAGCTATGATTGG No data
1136800090_1136800099 26 Left 1136800090 16:33062025-33062047 CCTGTGTTTAAAATTTTTAAAAA No data
Right 1136800099 16:33062074-33062096 GGACTATGCCAGCTATGATTGGG No data
1136800090_1136800097 5 Left 1136800090 16:33062025-33062047 CCTGTGTTTAAAATTTTTAAAAA No data
Right 1136800097 16:33062053-33062075 GGGAAGTGTAATGCAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136800090 Original CRISPR TTTTTAAAAATTTTAAACAC AGG (reversed) Intergenic
No off target data available for this crispr