ID: 1136800097

View in Genome Browser
Species Human (GRCh38)
Location 16:33062053-33062075
Sequence GGGAAGTGTAATGCAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136800090_1136800097 5 Left 1136800090 16:33062025-33062047 CCTGTGTTTAAAATTTTTAAAAA No data
Right 1136800097 16:33062053-33062075 GGGAAGTGTAATGCAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136800097 Original CRISPR GGGAAGTGTAATGCAAAATG TGG Intergenic
No off target data available for this crispr