ID: 1136803218

View in Genome Browser
Species Human (GRCh38)
Location 16:33101570-33101592
Sequence GCACGTGGCCATCAGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136803215_1136803218 7 Left 1136803215 16:33101540-33101562 CCCTAACTACTGGGTTCAGGGCA No data
Right 1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG No data
1136803216_1136803218 6 Left 1136803216 16:33101541-33101563 CCTAACTACTGGGTTCAGGGCAC No data
Right 1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG No data
1136803210_1136803218 20 Left 1136803210 16:33101527-33101549 CCATGAAGTATATCCCTAACTAC No data
Right 1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG No data
1136803208_1136803218 28 Left 1136803208 16:33101519-33101541 CCACAGGCCCATGAAGTATATCC No data
Right 1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG No data
1136803209_1136803218 21 Left 1136803209 16:33101526-33101548 CCCATGAAGTATATCCCTAACTA No data
Right 1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136803218 Original CRISPR GCACGTGGCCATCAGCTCAC AGG Intergenic
No off target data available for this crispr