ID: 1136804840

View in Genome Browser
Species Human (GRCh38)
Location 16:33117924-33117946
Sequence CCTGCTAACCAGACAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136804835_1136804840 -1 Left 1136804835 16:33117902-33117924 CCTTCCTGTACAAATTGTACCTC No data
Right 1136804840 16:33117924-33117946 CCTGCTAACCAGACAGCAGAGGG No data
1136804836_1136804840 -5 Left 1136804836 16:33117906-33117928 CCTGTACAAATTGTACCTCCTGC No data
Right 1136804840 16:33117924-33117946 CCTGCTAACCAGACAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136804840 Original CRISPR CCTGCTAACCAGACAGCAGA GGG Intergenic
No off target data available for this crispr