ID: 1136807207

View in Genome Browser
Species Human (GRCh38)
Location 16:33141018-33141040
Sequence GGTGCGCAGGGCCTGCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807207_1136807217 11 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807217 16:33141052-33141074 ACCCCGGGCGCAGCTCAGCCTGG No data
1136807207_1136807224 27 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807224 16:33141068-33141090 AGCCTGGGCACACCCGAGAGGGG No data
1136807207_1136807214 -5 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807214 16:33141036-33141058 GCACCAGGTGAGGGCGACCCCGG No data
1136807207_1136807219 12 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807219 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
1136807207_1136807223 26 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807207_1136807222 25 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807207_1136807215 -4 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807207 Original CRISPR GGTGCGCAGGGCCTGCCAGG CGG (reversed) Intergenic