ID: 1136807208

View in Genome Browser
Species Human (GRCh38)
Location 16:33141021-33141043
Sequence CCTGGTGCGCAGGGCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807208_1136807226 30 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807226 16:33141074-33141096 GGCACACCCGAGAGGGGACCAGG No data
1136807208_1136807215 -7 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data
1136807208_1136807222 22 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807208_1136807214 -8 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807214 16:33141036-33141058 GCACCAGGTGAGGGCGACCCCGG No data
1136807208_1136807223 23 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807208_1136807219 9 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807219 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
1136807208_1136807217 8 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807217 16:33141052-33141074 ACCCCGGGCGCAGCTCAGCCTGG No data
1136807208_1136807224 24 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807224 16:33141068-33141090 AGCCTGGGCACACCCGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807208 Original CRISPR CCTGGTGCGCAGGGCCTGCC AGG (reversed) Intergenic