ID: 1136807213

View in Genome Browser
Species Human (GRCh38)
Location 16:33141031-33141053
Sequence GTCGCCCTCACCTGGTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807213_1136807219 -1 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807219 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
1136807213_1136807223 13 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807213_1136807227 24 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807227 16:33141078-33141100 CACCCGAGAGGGGACCAGGCCGG No data
1136807213_1136807228 25 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807228 16:33141079-33141101 ACCCGAGAGGGGACCAGGCCGGG No data
1136807213_1136807230 26 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807213_1136807232 27 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807232 16:33141081-33141103 CCGAGAGGGGACCAGGCCGGGGG No data
1136807213_1136807222 12 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807213_1136807217 -2 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807217 16:33141052-33141074 ACCCCGGGCGCAGCTCAGCCTGG No data
1136807213_1136807224 14 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807224 16:33141068-33141090 AGCCTGGGCACACCCGAGAGGGG No data
1136807213_1136807226 20 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807226 16:33141074-33141096 GGCACACCCGAGAGGGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807213 Original CRISPR GTCGCCCTCACCTGGTGCGC AGG (reversed) Intergenic