ID: 1136807215

View in Genome Browser
Species Human (GRCh38)
Location 16:33141037-33141059
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807205_1136807215 8 Left 1136807205 16:33141006-33141028 CCGACATCAACGCCGCCTGGCAG No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data
1136807207_1136807215 -4 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data
1136807203_1136807215 16 Left 1136807203 16:33140998-33141020 CCTCTACGCCGACATCAACGCCG No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data
1136807200_1136807215 30 Left 1136807200 16:33140984-33141006 CCCTCCGAGACGAACCTCTACGC No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data
1136807201_1136807215 29 Left 1136807201 16:33140985-33141007 CCTCCGAGACGAACCTCTACGCC No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data
1136807202_1136807215 26 Left 1136807202 16:33140988-33141010 CCGAGACGAACCTCTACGCCGAC No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data
1136807208_1136807215 -7 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807215 16:33141037-33141059 CACCAGGTGAGGGCGACCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807215 Original CRISPR CACCAGGTGAGGGCGACCCC GGG Intergenic