ID: 1136807216

View in Genome Browser
Species Human (GRCh38)
Location 16:33141039-33141061
Sequence CGCCCGGGGTCGCCCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807216_1136807227 16 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807227 16:33141078-33141100 CACCCGAGAGGGGACCAGGCCGG No data
1136807216_1136807217 -10 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807217 16:33141052-33141074 ACCCCGGGCGCAGCTCAGCCTGG No data
1136807216_1136807228 17 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807228 16:33141079-33141101 ACCCGAGAGGGGACCAGGCCGGG No data
1136807216_1136807230 18 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807216_1136807219 -9 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807219 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
1136807216_1136807226 12 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807226 16:33141074-33141096 GGCACACCCGAGAGGGGACCAGG No data
1136807216_1136807237 30 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807237 16:33141092-33141114 CCAGGCCGGGGGCCAGGGGCCGG No data
1136807216_1136807223 5 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807216_1136807233 24 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807233 16:33141086-33141108 AGGGGACCAGGCCGGGGGCCAGG No data
1136807216_1136807222 4 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807216_1136807234 25 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807234 16:33141087-33141109 GGGGACCAGGCCGGGGGCCAGGG No data
1136807216_1136807232 19 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807232 16:33141081-33141103 CCGAGAGGGGACCAGGCCGGGGG No data
1136807216_1136807235 26 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807235 16:33141088-33141110 GGGACCAGGCCGGGGGCCAGGGG No data
1136807216_1136807224 6 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807224 16:33141068-33141090 AGCCTGGGCACACCCGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807216 Original CRISPR CGCCCGGGGTCGCCCTCACC TGG (reversed) Intergenic