ID: 1136807218

View in Genome Browser
Species Human (GRCh38)
Location 16:33141053-33141075
Sequence CCCAGGCTGAGCTGCGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807218_1136807227 2 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807227 16:33141078-33141100 CACCCGAGAGGGGACCAGGCCGG No data
1136807218_1136807247 28 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807247 16:33141104-33141126 CCAGGGGCCGGGGGGAGGGGCGG No data
1136807218_1136807238 17 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807238 16:33141093-33141115 CAGGCCGGGGGCCAGGGGCCGGG No data
1136807218_1136807233 10 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807233 16:33141086-33141108 AGGGGACCAGGCCGGGGGCCAGG No data
1136807218_1136807228 3 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807228 16:33141079-33141101 ACCCGAGAGGGGACCAGGCCGGG No data
1136807218_1136807243 23 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807243 16:33141099-33141121 GGGGGCCAGGGGCCGGGGGGAGG No data
1136807218_1136807237 16 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807237 16:33141092-33141114 CCAGGCCGGGGGCCAGGGGCCGG No data
1136807218_1136807234 11 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807234 16:33141087-33141109 GGGGACCAGGCCGGGGGCCAGGG No data
1136807218_1136807223 -9 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807223 16:33141067-33141089 CAGCCTGGGCACACCCGAGAGGG No data
1136807218_1136807230 4 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807230 16:33141080-33141102 CCCGAGAGGGGACCAGGCCGGGG No data
1136807218_1136807235 12 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807235 16:33141088-33141110 GGGACCAGGCCGGGGGCCAGGGG No data
1136807218_1136807232 5 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807232 16:33141081-33141103 CCGAGAGGGGACCAGGCCGGGGG No data
1136807218_1136807226 -2 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807226 16:33141074-33141096 GGCACACCCGAGAGGGGACCAGG No data
1136807218_1136807240 19 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807240 16:33141095-33141117 GGCCGGGGGCCAGGGGCCGGGGG No data
1136807218_1136807239 18 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807239 16:33141094-33141116 AGGCCGGGGGCCAGGGGCCGGGG No data
1136807218_1136807224 -8 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807224 16:33141068-33141090 AGCCTGGGCACACCCGAGAGGGG No data
1136807218_1136807244 24 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807244 16:33141100-33141122 GGGGCCAGGGGCCGGGGGGAGGG No data
1136807218_1136807222 -10 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807218_1136807241 20 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807241 16:33141096-33141118 GCCGGGGGCCAGGGGCCGGGGGG No data
1136807218_1136807248 29 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807248 16:33141105-33141127 CAGGGGCCGGGGGGAGGGGCGGG No data
1136807218_1136807245 25 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807245 16:33141101-33141123 GGGCCAGGGGCCGGGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807218 Original CRISPR CCCAGGCTGAGCTGCGCCCG GGG (reversed) Intergenic