ID: 1136807222

View in Genome Browser
Species Human (GRCh38)
Location 16:33141066-33141088
Sequence TCAGCCTGGGCACACCCGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136807216_1136807222 4 Left 1136807216 16:33141039-33141061 CCAGGTGAGGGCGACCCCGGGCG No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807208_1136807222 22 Left 1136807208 16:33141021-33141043 CCTGGCAGGCCCTGCGCACCAGG No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807207_1136807222 25 Left 1136807207 16:33141018-33141040 CCGCCTGGCAGGCCCTGCGCACC No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807213_1136807222 12 Left 1136807213 16:33141031-33141053 CCTGCGCACCAGGTGAGGGCGAC No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807212_1136807222 13 Left 1136807212 16:33141030-33141052 CCCTGCGCACCAGGTGAGGGCGA No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data
1136807218_1136807222 -10 Left 1136807218 16:33141053-33141075 CCCCGGGCGCAGCTCAGCCTGGG No data
Right 1136807222 16:33141066-33141088 TCAGCCTGGGCACACCCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136807222 Original CRISPR TCAGCCTGGGCACACCCGAG AGG Intergenic